| Detail of EST/Unigene FG175876 |
| Acc. | FG175876 |
| Internal Acc. | AGN_RNC121xg20f1.ab1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin, cytoplasmic OS=Biomphalaria tenagophila E-value=6e-68; Actin, cytoplasmic OS=Biomphalaria alexandrina E-value=6e-68; Actin, cytoplasmic OS=Styela plicata E-value=8e-68; Actin, cytoplasmic OS=Biomphalaria obstructa E-value=1e-67; Actin, cytoplasmic OS=Helisoma trivolvis E-value=3e-67; |
| Length | 701 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RNC (1 ESTs); |
| Sequence | ACACATCAAAGTTTTATTAATTCTTACACTTAAAAAAACTCCATTCGAGAGCGTCCACAA |
| EST members of Unigene | FG175876 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830841 |
| Trichome-related Gene from Literature | 830841 |