Detail of EST/Unigene FG638751 |
Acc. | FG638751 |
Internal Acc. | TT-06_O08 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; |
Length | 813 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TRI (1 ESTs); |
Sequence | ACAGCTAACATCTCTATTACTTCAGCCATCAAAAAAACACTTACTTCTCCTTGCTAAACC |
EST members of Unigene | FG638751 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |