Detail of EST/Unigene FG639221 |
Acc. | FG639221 |
Internal Acc. | TT-17_P24 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-47; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-46; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=8e-46; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-45; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-45; |
Length | 397 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TRI (1 ESTs); |
Sequence | ACAGCTAACATCTCTATTACTTCAGCCATCAAAAAAACACTTACTTCTCCTTGCTAAACC |
EST members of Unigene | FG639221 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |