| Detail of EST/Unigene FS192224 |
| Acc. | FS192224 |
| Internal Acc. | FS192224 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-11; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-10; Gamma-glutamyltransferase 7 OS=Homo sapiens E-value=3e-08; Gamma-glutamyltransferase 7 OS=Bos taurus E-value=3e-08; Gamma-glutamyltranspeptidase OS=Bacillus subtilis (strain 168) E-value=6e-08; |
| Length | 312 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024426 (1 ESTs); |
| Sequence | TTTTTTCTTTGCTTTTTATTTGCATTCATTGCCATAACATTTGTTGGGCTTACACATCAT |
| EST members of Unigene | FS192224 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |