Detail of EST/Unigene FS203388 |
Acc. | FS203388 |
Internal Acc. | FS203388 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=6e-90; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=5e-73; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=1e-47; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=7e-47; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=4e-41; |
Length | 641 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_024426 (1 ESTs); |
Sequence | ACACCAAAATCCTAATCATTTTGCTGATACCCAATTGTCTCTATATATATATTGGAAGGT |
EST members of Unigene | FS203388 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |