Detail of EST/Unigene GE343351 |
Acc. | GE343351 |
Internal Acc. | MEUA029TF |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=5e-48; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=7e-46; Ferredoxin-6, chloroplastic OS=Zea mays E-value=2e-40; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=5e-40; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=7e-39; |
Length | 648 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (1 ESTs); |
Sequence | GCATGGCATCCTTGTCAGCTGTGAATGTTTCCCCGCTATGCATGATTCAAACTGCAAACC |
EST members of Unigene | GE343351 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42860.1.S1_at
|
Corresponding NCBI Gene | 817297 |
Trichome-related Gene from Literature | N/A |