Detail of EST/Unigene GE344183 |
Acc. | GE344183 |
Internal Acc. | MEUA993TF |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, cytosolic OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=0; Serine hydroxymethyltransferase, cytosolic OS=Candida albicans (strain SC5314 / ATCC MYA-2876) E-value=0; Serine hydroxymethyltransferase, cytosolic OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) E-value=0; Serine hydroxymethyltransferase, cytosolic OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=0; Serine hydroxymethyltransferase, cytosolic OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=0; |
Length | 753 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (1 ESTs); |
Sequence | GGGCTATGACATGCTTGAGAAGACCGCTCAACTCTACCGCCCCAAGACCCTTGTCGCCGG |
EST members of Unigene | GE344183 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |