| Detail of EST/Unigene GR221380 |
| Acc. | GR221380 |
| Internal Acc. | CAN011_2006-03-17_1/CAN011_D03_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Arabidopsis thaliana E-value=9e-28; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=6e-27; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=1e-26; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=4e-26; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=4e-26; |
| Length | 449 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | CS_GT (1 ESTs); |
| Sequence | GAATAGAAATATTTATTCCATTATATATAGTTTTTTCTCAATATAATATACATATTGATT |
| EST members of Unigene | GR221380 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |