Detail of EST/Unigene GR221380 |
Acc. | GR221380 |
Internal Acc. | CAN011_2006-03-17_1/CAN011_D03_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Arabidopsis thaliana E-value=9e-28; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=6e-27; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=1e-26; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=4e-26; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=4e-26; |
Length | 449 nt |
Species | Cannabis sativa |
Belonged EST Libraries | CS_GT (1 ESTs); |
Sequence | GAATAGAAATATTTATTCCATTATATATAGTTTTTTCTCAATATAATATACATATTGATT |
EST members of Unigene | GR221380 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |