| Detail of EST/Unigene GW331378 |
| Acc. | GW331378 |
| Internal Acc. | AAGST_UP_015_C03_25AUG2005_027 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=4e-52; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=5e-50; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=6e-39; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=6e-39; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=2e-38; |
| Length | 476 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | LIBEST_025693 (1 ESTs); |
| Sequence | TTCGGAGATGGAATTGACAGGTCAGCCAATGAGTTCAAAGACATGGTAGTAGAGTTAATG |
| EST members of Unigene | GW331378 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830693 |
| Trichome-related Gene from Literature | 830693 |