Detail of EST/Unigene GW333165 |
Acc. | GW333165 |
Internal Acc. | AAGST_UP_045_B11_31OCT2005_093 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | E3 ubiquitin-protein ligase UPL1 OS=Arabidopsis thaliana E-value=1e-10; E3 ubiquitin-protein ligase UPL2 OS=Arabidopsis thaliana E-value=2e-10; |
Length | 126 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025693 (1 ESTs); |
Sequence | CTTCCACAAAAGTTTTTGACATCAATGGCTCCTCTTATATCTCGAGACCCTGCGATTTTT |
EST members of Unigene | GW333165 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842036 |
Trichome-related Gene from Literature | 842036 |