Detail of EST/Unigene TCAA50981 |
Acc. | TCAA50981 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aquaporin TIP2-1 OS=Arabidopsis thaliana E-value=6e-84; Probable aquaporin TIP-type OS=Antirrhinum majus E-value=4e-81; Probable aquaporin TIP-type RB7-5A OS=Nicotiana tabacum E-value=9e-80; Probable aquaporin TIP-type RB7-18C OS=Nicotiana tabacum E-value=1e-79; Aquaporin TIP2-1 OS=Zea mays E-value=3e-79; |
Length | 958 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_GTRI5 (2 ESTs); AA_CAIY (1 ESTs); |
Sequence | CTCTCACTCATAATTTAAGAGTAGCTCCCATTATTTTTATAAAAAAAAAATGCCTGGAAT |
EST members of Unigene | EY078957 EY100922 EY078802 EY078801 EY074823 EY076380 EY091740 EY078958 EY091741 EY035829 EY035830 EY115365 EY115366 EY099379 EY074822 EY076379 EY080386 EY089240 EY083908 EY089241 EY083909 EY038254 EY038255 EY100921 EY079996 EY069112 EY069113 EY091783 EY091784 EY080385 EY115097 EY099380 EY115096 EY111720 EY086667 EY086668 EY089524 EY089525 EY107804 EY044143 EY107805 EY044144 EY105826 EY105827 EY098250 EY098251 EY111719 EY081883 EY081882 EY111117 EY111118 EY078689 EY078690 EY075332 EY075333 EY070770 EY079498 EY095566 EY073346 EY073345 EY095565 EY079499 EY070771 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.8 Major intrinsic protein MIP |
Probeset |
|
Corresponding NCBI Gene | 820870 |
Trichome-related Gene from Literature | 820870 |