Detail of EST/Unigene TCAA51691 |
Acc. | TCAA51691 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=0; Trans-cinnamate 4-monooxygenase OS=Zinnia elegans E-value=0; Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=0; |
Length | 1814 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (22 ESTs); AA_CAIY (2 ESTs); LIBEST_025694 (1 ESTs); |
Sequence | CGGTAACTCCGCCACTATTAACCACCGTCCACCAACATTCAACTACCATCATGGATCTTC |
EST members of Unigene | EY087742 GW334786 EY108200 EY096195 EY087741 EY043629 EY043628 EY109750 EY109749 EY089794 EY089793 EY096196 EY108201 EY106835 EY085723 EY085722 EY110153 EY110152 EY112723 EY112722 EY106396 EY106395 EY081077 EY081076 EY106836 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |