Detail of EST/Unigene TCAA51740 |
Acc. | TCAA51740 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=0; |
Length | 1749 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (28 ESTs); AA_CAIY (4 ESTs); AA_GTRI4 (4 ESTs); LIBEST_025693 (3 ESTs); AA_GTRI3 (2 ESTs); |
Sequence | GTTTTTCTTCTTCTTCTACTGCTAAAACAACAATTTTATAAAAAAAGAATGGACCGAGCA |
EST members of Unigene | EY115359 EY115360 EY094506 EY094507 GW333241 EY109222 EY109223 EY100657 EY091152 EY091151 EY042502 EY102224 EY102225 EY100001 EY100002 EY093008 EY093009 EY095097 EY042501 EY100658 EY060309 GW333073 EY090740 EY090741 EY088994 EY088995 EY109140 EY109141 EY066292 EY066293 EY088202 EY038507 EY038506 EY099942 EY099943 EY060310 EY101225 EY101226 EY053805 EY053806 GW329751 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |