Detail of EST/Unigene TCAA51800 |
Acc. | TCAA51800 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase OS=Glycine max E-value=0; 1-aminocyclopropane-1-carboxylate synthase 6 OS=Arabidopsis thaliana E-value=0; 1-aminocyclopropane-1-carboxylate synthase 1 OS=Prunus mume E-value=0; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=0; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=0; |
Length | 1672 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (8 ESTs); AA_GTRI4 (1 ESTs); AA_GTRI5 (1 ESTs); |
Sequence | CTAAACTTCACTAAAAAATGGAGGTTGCATTGAACAACAACCACAAGTTTTTTATCCAAG |
EST members of Unigene | EY088800 EY088801 EY071171 EY065199 EY095469 EY095470 EY076661 EY076662 EY093101 EY093102 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826730 |
Trichome-related Gene from Literature | 826730 |