Detail of EST/Unigene TCAA52568 |
Acc. | TCAA52568 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Citrullus lanatus E-value=0; Cysteine synthase OS=Solanum tuberosum E-value=0; Cysteine synthase OS=Brassica juncea E-value=0; Cysteine synthase OS=Arabidopsis thaliana E-value=0; Cysteine synthase OS=Brassica juncea E-value=0; |
Length | 1285 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (22 ESTs); AA_CAIY (4 ESTs); AA_GTRI4 (2 ESTs); LIBEST_025692 (1 ESTs); |
Sequence | GTGCCTTGTTTTATTTAAAGTGGTTTTGTGTTTTTGAGTTATTAAAGGTTTTGATCTGAG |
EST members of Unigene | EY099122 EY099121 EY109219 EY109218 EY110741 EY110740 EY041070 EY107656 EY080754 EY080753 EY115751 EY115750 GW328671 EY037324 EY037325 EY066700 EY112031 EY112030 EY041069 EY075283 EY075282 EY113877 EY113876 EY107655 EY066701 EY106346 EY106347 EY098807 EY098808 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |