Detail of EST/Unigene TCAA53318 |
Acc. | TCAA53318 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; |
Length | 1026 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY (67 ESTs); AA_GTRI4 (22 ESTs); AA_CAZI (11 ESTs); AA_GTRI3 (9 ESTs); AA_CAIW (6 ESTs); LIBEST_025692 (5 ESTs); AA_CAIT (4 ESTs); |
Sequence | GAAGCAGTCAACTTCAACTACCATTTTTCTCATTAGTCTTACCATCTACTTTGAAAATAC |
EST members of Unigene | EY042093 EY041031 EY056600 EY042094 EY042348 EY042349 EY056599 EY039217 EY039178 EY073788 EY040772 EY040771 EY046283 EY038153 GW329125 EY042463 EY037291 EY037290 EY046228 EY040813 EY040188 EY040812 EY039611 EY042361 EY039610 EY042360 EY061780 EY055816 EY055815 EY055200 EY036748 EY038152 EY037176 EY040635 EY040634 EY045264 EY045263 EY041685 EY041684 EY042498 EY042497 EY044607 EY044606 EY060089 EY041190 EY037177 EY067539 EY042007 EY046139 EY062165 EY046138 EY062164 EY059649 EY059648 EY038517 EY050134 EY038516 EY041030 GW329093 EY035023 EY042008 EY041189 EY046332 EY061977 EY038126 EY038125 EY037512 EY067002 EY067001 EY056006 EY032232 EY056005 EY032231 EY040564 EY040563 EY061713 EY061382 EY061383 EY080694 EY046331 EY060088 EY036790 EY066353 EY033125 EY110845 EY033124 EY036780 GW328410 EY043794 EY033347 EY043793 EY033346 EY061712 EY103708 EY041280 EY041279 EY031955 EY031954 GW328137 EY059714 EY059713 EY034126 EY043674 EY037296 EY037295 EY033599 EY033598 EY046229 GW328980 EY109613 EY103707 EY038027 EY038026 EY088051 EY085410 EY088050 EY061504 EY061503 EY055201 EY097255 EY116037 EY054867 EY054868 EY046282 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |