Detail of EST/Unigene TCAA53419 |
Acc. | TCAA53419 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Non-specific lipid-transfer protein OS=Helianthus annuus E-value=2e-38; Non-specific lipid-transfer protein OS=Gerbera hybrida E-value=1e-35; Non-specific lipid-transfer protein 2 OS=Nicotiana tabacum E-value=6e-30; Non-specific lipid-transfer protein 1 OS=Nicotiana tabacum E-value=2e-29; Non-specific lipid-transfer protein OS=Spinacia oleracea E-value=4e-29; |
Length | 962 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_GTRI3 (22 ESTs); AA_GTRI4 (19 ESTs); AA_CAIY (14 ESTs); AA_GTRI5 (6 ESTs); AA_CAZI (2 ESTs); AA_CAIW (2 ESTs); LIBEST_025692 (1 ESTs); |
Sequence | AGTTAATAGTGAGATAGAGAAAATATGTAAAGGACATGCATGTTGGAACCAAGTTTACAA |
EST members of Unigene | EY037376 EY037375 EY050325 EY050324 EY050321 EY068635 EY069769 EY069770 EY049974 EY065944 GW329557 EY061881 EY061882 EY060594 EY060595 EY050320 EY068634 EY038995 EY050644 EY035080 EY035081 EY063014 EY063015 EY067513 EY067514 EY038947 EY038948 EY054010 EY054011 EY062109 EY062110 EY038994 EY050643 EY053433 EY049975 EY051753 EY051754 EY061622 EY061623 EY056232 EY056233 EY051187 EY051188 EY053980 EY053981 EY062782 EY034716 EY062783 EY034717 EY068162 EY049120 EY053434 EY068161 EY038062 EY038063 EY064966 EY064967 EY109336 EY045732 EY109337 EY049119 EY066699 EY033287 EY066698 EY033286 EY045733 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836051 |
Trichome-related Gene from Literature | 836051 |