| Detail of EST/Unigene TCHL50440 |
| Acc. | TCHL50440 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Citrullus lanatus E-value=0; Cysteine synthase OS=Brassica juncea E-value=0; Cysteine synthase OS=Solanum tuberosum E-value=0; Cysteine synthase OS=Arabidopsis thaliana E-value=0; Cysteine synthase OS=Brassica juncea E-value=0; |
| Length | 1388 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | |
| Sequence | AAGTTTGCTTATGATTGTCTAAAATCAATGATAGCGATAAAATACATACAAGGAGACTCT |
| EST members of Unigene | SRR546165.189185 SRR546165.274795 SRR546168.77869 SRR546165.193407 SRR546172.51447 SRR546172.48162 SRR546165.137929 SRR546165.60428 SRR546168.96752 SRR546165.186287 SRR546168.77500 SRR546165.119232 SRR546168.98597 SRR546172.167833 SRR546168.135694 SRR546172.124363 SRR546170.107656 SRR546172.50345 SRR546165.102248 SRR546172.64639 SRR546170.82907 SRR546172.138360 SRR546165.254626 SRR546165.278932 SRR546168.136896 SRR546165.13784 SRR546168.68676 SRR546170.100340 SRR546172.42071 SRR546170.74645 SRR546165.31946 SRR546170.37931 SRR546172.8453 SRR546168.55550 SRR546172.136388 SRR546170.128216 SRR546165.99441 SRR546170.117201 SRR546172.145110 SRR546165.56917 SRR546170.64444 SRR546168.105025 SRR546170.70231 SRR546168.46475 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827145 |
| Trichome-related Gene from Literature | 827145 |