| Detail of EST/Unigene TCHL54425 |
| Acc. | TCHL54425 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WRKY transcription factor 44 OS=Arabidopsis thaliana E-value=9e-68; Probable WRKY transcription factor 3 OS=Arabidopsis thaliana E-value=2e-65; Probable WRKY transcription factor 33 OS=Arabidopsis thaliana E-value=6e-63; Probable WRKY transcription factor 4 OS=Arabidopsis thaliana E-value=5e-62; Probable WRKY transcription factor 2 OS=Arabidopsis thaliana E-value=7e-57; |
| Length | 1538 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (28 ESTs); SRR546172 (14 ESTs); HL_TRI (6 ESTs); SRR546168 (3 ESTs); SRR546170 (3 ESTs); HLUPLC (1 ESTs); HLUTR3CH (1 ESTs); |
| Sequence | TATATCAAATTTTCTCACTTGTTATTTCCAGTAAAAAATTCAAAGAAGAAGAAAAAAAAG |
| EST members of Unigene | SRR546165.34581 SRR546172.12606 SRR546170.90019 ES658680 SRR546172.42564 SRR546165.246556 SRR546165.244236 SRR546165.135437 SRR546168.95045 SRR546165.24115 SRR546165.276691 GD248961 SRR546165.73776 SRR546168.122502 ES656386 SRR546165.275415 SRR546165.308064 SRR546172.144825 ES656054 ES656052 SRR546165.225346 SRR546172.114683 SRR546165.57789 SRR546165.296639 SRR546165.232483 EX519844 SRR546165.129663 SRR546172.103114 SRR546170.117912 SRR546172.76681 SRR546165.270446 SRR546165.273915 SRR546165.14178 SRR546172.170003 SRR546165.276803 SRR546172.159560 SRR546165.100166 SRR546172.89607 SRR546172.96177 SRR546165.223650 SRR546170.131436 SRR546165.279141 SRR546172.143743 GD245066 SRR546165.293292 SRR546172.12187 SRR546165.49415 SRR546165.253292 SRR546168.101779 SRR546172.25130 SRR546165.154147 SRR546165.286300 SRR546172.62215 ES658484 SRR546165.282833 SRR546165.154144 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818303 |
| Trichome-related Gene from Literature | 818303 |