| Detail of EST/Unigene TCHL57433 |
| Acc. | TCHL57433 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-81; Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=2e-80; Allene oxide synthase OS=Parthenium argentatum E-value=2e-80; 9-divinyl ether synthase OS=Solanum lycopersicum E-value=7e-79; 9-divinyl ether synthase OS=Solanum tuberosum E-value=1e-78; |
| Length | 1090 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (10 ESTs); SRR546172 (9 ESTs); SRR546170 (7 ESTs); SRR546168 (3 ESTs); HLUTR2CH (1 ESTs); HLUTR3CH (1 ESTs); HLUPLC (1 ESTs); HLUPJN1 (1 ESTs); |
| Sequence | TCTCTTTTGCGAAGGGAAGCCGACGGAACGTGGGCTTGGGCCCAAAGCAAACACTGATTT |
| EST members of Unigene | GD247452 GD245031 SRR546172.145367 SRR546170.142762 GD252492 SRR546165.200754 SRR546165.245222 SRR546165.84250 SRR546172.98441 SRR546168.60111 SRR546170.52971 SRR546165.305359 SRR546168.75406 SRR546165.227302 GD243953 SRR546172.60917 SRR546170.113770 SRR546172.10655 SRR546165.217640 SRR546168.96880 SRR546172.70288 SRR546165.100555 SRR546170.48791 SRR546170.57493 SRR546165.143493 SRR546172.169449 SRR546165.53245 SRR546165.325180 SRR546170.41880 SRR546172.120599 SRR546172.111686 SRR546172.47336 SRR546170.137475 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00489 cytochrome P450, family 7, subfamily A (cholesterol 7alpha-monooxygenase) |
| EC | 1.14.13.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834273 |
| Trichome-related Gene from Literature | 834273 |