Detail of EST/Unigene TCHL57655 |
Acc. | TCHL57655 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=0; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=0; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=0; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=0; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=0; |
Length | 1069 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168 (12 ESTs); SRR546172 (10 ESTs); SRR546170 (4 ESTs); SRR546165 (1 ESTs); |
Sequence | TTTCTTTATACTTGTACAATCAGTTTTAACTTTATTTTCGATACGGTAAATTATTTAGAA |
EST members of Unigene | SRR546168.3050 SRR546168.97732 SRR546170.111641 SRR546168.43855 SRR546172.169531 SRR546172.97092 SRR546172.150223 SRR546165.290263 SRR546168.80026 SRR546172.158539 SRR546168.16086 SRR546172.18654 SRR546168.108148 SRR546170.20208 SRR546168.60398 SRR546172.71621 SRR546168.99187 SRR546168.59772 SRR546170.116179 SRR546172.67771 SRR546172.93487 SRR546172.76865 SRR546168.55178 SRR546172.59108 SRR546170.107325 SRR546168.87051 SRR546168.25606 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |