| Detail of EST/Unigene TCHL57699 |
| Acc. | TCHL57699 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein phosphatase 2C 16 OS=Arabidopsis thaliana E-value=3e-91; Probable protein phosphatase 2C 6 OS=Oryza sativa subsp. japonica E-value=1e-87; Protein phosphatase 2C 7 OS=Arabidopsis thaliana E-value=5e-87; Probable protein phosphatase 2C 53 OS=Oryza sativa subsp. japonica E-value=7e-87; Probable protein phosphatase 2C 50 OS=Oryza sativa subsp. japonica E-value=6e-80; |
| Length | 1065 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (25 ESTs); SRR546172 (18 ESTs); SRR546165 (14 ESTs); SRR546168 (7 ESTs); HLUPLC (1 ESTs); HL_TRI (1 ESTs); |
| Sequence | CGAATCCCCATTAAATGCACAGGAGGATTTTCTTGAACTAAAATAAGGACAAGCAAAATT |
| EST members of Unigene | SRR546165.106238 SRR546170.61997 SRR546170.90006 SRR546168.85780 SRR546165.237842 SRR546170.29716 SRR546168.83053 SRR546172.53937 SRR546165.167103 SRR546172.106109 SRR546170.156643 SRR546170.139275 SRR546172.97836 SRR546168.114377 SRR546165.255482 SRR546170.79035 SRR546172.30609 SRR546170.145678 SRR546170.93706 SRR546165.309761 SRR546172.76969 SRR546172.111374 SRR546170.5011 SRR546170.11577 SRR546165.312061 SRR546172.64945 SRR546168.107370 SRR546172.149563 SRR546172.54448 GD245478 SRR546165.314472 EX518609 SRR546170.79862 SRR546165.54554 SRR546172.67575 SRR546172.28923 SRR546170.8369 SRR546170.75608 SRR546170.64980 SRR546168.95733 SRR546170.107892 SRR546165.194896 SRR546172.19879 SRR546172.27416 SRR546170.72362 SRR546165.61927 SRR546168.41837 SRR546170.146729 SRR546170.67907 SRR546165.315257 SRR546172.59288 SRR546172.133679 SRR546170.166033 SRR546165.228430 SRR546172.113546 SRR546170.127168 SRR546165.14521 SRR546165.225942 SRR546172.148501 SRR546170.162716 SRR546172.156220 SRR546168.93356 SRR546170.91022 SRR546170.55089 SRR546170.104929 SRR546170.48518 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04461 protein phosphatase 1B (formerly 2C) |
| EC | 3.1.3.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843609 |
| Trichome-related Gene from Literature | 843609 |