Detail of EST/Unigene TCHL59358 |
Acc. | TCHL59358 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Sucrose synthase 2 OS=Pisum sativum E-value=0; Sucrose synthase 4 OS=Oryza sativa subsp. japonica E-value=0; Sucrose synthase 3 OS=Arabidopsis thaliana E-value=0; Sucrose synthase (Fragment) OS=Beta vulgaris E-value=0; Sucrose synthase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 916 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (25 ESTs); SRR546165 (10 ESTs); SRR546170 (8 ESTs); SRR546168 (4 ESTs); HL_HIF_HSS (1 ESTs); HL_TRI (1 ESTs); |
Sequence | CACACAAAGAAAAGAAAGGTTATATTAAACATTACAAGGGTTCCATCTTCCATGAGAGTC |
EST members of Unigene | SRR546172.116394 SRR546172.55330 SRR546165.135650 SRR546168.7548 SRR546172.102286 SRR546170.29356 SRR546165.247525 SRR546172.164295 SRR546170.144879 SRR546170.160928 SRR546172.150989 SRR546165.28988 SRR546172.146933 SRR546172.5902 SRR546172.151022 SRR546168.24973 SRR546172.117013 SRR546172.170916 SRR546172.71781 SRR546168.86015 SRR546170.150531 SRR546172.76603 SRR546170.75754 CO653524 SRR546172.120630 SRR546165.206157 SRR546172.102208 SRR546165.57876 SRR546172.126353 SRR546168.17692 SRR546165.169755 SRR546165.90508 SRR546172.134824 ES652402 SRR546172.129212 SRR546170.55902 SRR546165.311224 SRR546172.120772 SRR546172.118840 SRR546172.27483 SRR546172.74238 SRR546172.157903 SRR546172.123513 SRR546172.126405 SRR546165.57920 SRR546172.158665 SRR546170.52314 SRR546165.10372 SRR546170.76442 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K03843 alpha-1,3/alpha-1,6-mannosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K03843 alpha-1,3/alpha-1,6-mannosyltransferase |
EC | 2.4.1.- 2.4.1.132 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828081 |
Trichome-related Gene from Literature | 828081 |