| Detail of EST/Unigene TCMS40378 |
| Acc. | TCMS40378 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione transferase GST 23 OS=Zea mays E-value=3e-50; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-48; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-47; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-47; Probable glutathione S-transferase OS=Glycine max E-value=1e-44; |
| Length | 528 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | AGGAGACTCACTCACGTTACTAGGGTTCTGGGGTAGTCCATTTGTCCTGAGGGTCAAGTG |
| EST members of Unigene | CO516142 CO515733 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1928.1.S1_at
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |