Detail of EST/Unigene TCMS40497 |
Acc. | TCMS40497 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase L3 OS=Arabidopsis thaliana E-value=3e-68; Glutathione S-transferase L1 OS=Arabidopsis thaliana E-value=6e-67; Protein IN2-1 homolog B OS=Oryza sativa subsp. japonica E-value=5e-60; Protein IN2-1 homolog B OS=Oryza sativa subsp. indica E-value=5e-60; Glutathione S-transferase L2, chloroplastic OS=Arabidopsis thaliana E-value=9e-60; |
Length | 560 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (6 ESTs); |
Sequence | AACTGTCGACGTGAAACAAGTTCTTCCTCCTCCGTTAACATCAACTTCTGAACCACCACC |
EST members of Unigene | CO515890 CO515298 CO515112 CO514735 CO512458 CO511776 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1872.1.S1_at
|
Corresponding NCBI Gene | 831798 |
Trichome-related Gene from Literature | N/A |