| Detail of EST/Unigene TCMS40624 |
| Acc. | TCMS40624 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=4e-44; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tabacum E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tomentosiformis E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Nicotiana sylvestris E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Solanum tuberosum E-value=3e-42; |
| Length | 542 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | GGGTTCTTGCAGAATTTATAGCTGGACAATTAAAGAATAGAATTTCGTTTAGGAAAGCAA |
| EST members of Unigene | CO516367 CO515247 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1730.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |