Detail of EST/Unigene TCMS40624 |
Acc. | TCMS40624 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=4e-44; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tabacum E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tomentosiformis E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Nicotiana sylvestris E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Solanum tuberosum E-value=3e-42; |
Length | 542 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | GGGTTCTTGCAGAATTTATAGCTGGACAATTAAAGAATAGAATTTCGTTTAGGAAAGCAA |
EST members of Unigene | CO516367 CO515247 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1730.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |