Detail of EST/Unigene TCMS40672 |
Acc. | TCMS40672 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=3e-97; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=1e-84; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tomentella E-value=1e-79; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Glycine max E-value=2e-79; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tabacina E-value=2e-79; |
Length | 749 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (32 ESTs); MS_TRI1 (12 ESTs); MS_CDS (1 ESTs); |
Sequence | GAAAAATGGCTTTGATCTCCTCCGCCGCTGTTACCACCGTTAACCGCGTCTCCGCTAACT |
EST members of Unigene | CO517013 CO516542 CO515405 CO515373 CO515312 CO514887 CO514520 CO513357 CO513203 CO512240 CO512167 CO511704 EX525927 EX525805 EX525160 EX525098 EX525054 EX525005 EX524983 EX524722 EX524373 EX524118 EX524090 EX524014 EX523938 EX523914 EX523896 EX523852 EX523807 EX523393 EX523123 EX523041 EX522979 EX522656 EX522557 EX522332 EX522322 EX522235 EX522117 EX521999 EX521900 EX521883 EX521840 EX521743 AF056315 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3144.1.S1_s_at, Mtr.19516.1.S1_at
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |