| Detail of EST/Unigene TCMS40858 |
| Acc. | TCMS40858 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L36, chloroplastic OS=Lotus japonicus E-value=3e-06; 50S ribosomal protein L36, chloroplastic OS=Pisum sativum E-value=5e-06; 50S ribosomal protein L36, chloroplastic OS=Nymphaea alba E-value=1e-05; 50S ribosomal protein L36, chloroplastic OS=Mesembryanthemum crystallinum E-value=1e-05; |
| Length | 583 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | TAAATTTGCCGATATCCGATTTGATTTCTATGAAAAAATTATATACATTATTGTAAATGG |
| EST members of Unigene | CO513040 CO512927 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.45610.1.S1_s_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |