Detail of EST/Unigene TCMS40858 |
Acc. | TCMS40858 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L36, chloroplastic OS=Lotus japonicus E-value=3e-06; 50S ribosomal protein L36, chloroplastic OS=Pisum sativum E-value=5e-06; 50S ribosomal protein L36, chloroplastic OS=Nymphaea alba E-value=1e-05; 50S ribosomal protein L36, chloroplastic OS=Mesembryanthemum crystallinum E-value=1e-05; |
Length | 583 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | TAAATTTGCCGATATCCGATTTGATTTCTATGAAAAAATTATATACATTATTGTAAATGG |
EST members of Unigene | CO513040 CO512927 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.45610.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |