| Detail of EST/Unigene TCMS40864 |
| Acc. | TCMS40864 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=2e-42; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=4e-42; Transketolase, chloroplastic OS=Solanum tuberosum E-value=3e-40; Transketolase, chloroplastic OS=Zea mays E-value=9e-40; Transketolase 7 OS=Craterostigma plantagineum E-value=6e-36; |
| Length | 588 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | GGGATTGGAACTGGTTCTGAGTTGGAAATTGCCGCTGCCGCCGCTGATGATCTAAGGAAA |
| EST members of Unigene | CO514060 CO512666 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3188.1.S1_at
|
| Corresponding NCBI Gene | 819137 |
| Trichome-related Gene from Literature | N/A |