Detail of EST/Unigene TCMS40864 |
Acc. | TCMS40864 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=2e-42; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=4e-42; Transketolase, chloroplastic OS=Solanum tuberosum E-value=3e-40; Transketolase, chloroplastic OS=Zea mays E-value=9e-40; Transketolase 7 OS=Craterostigma plantagineum E-value=6e-36; |
Length | 588 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | GGGATTGGAACTGGTTCTGAGTTGGAAATTGCCGCTGCCGCCGCTGATGATCTAAGGAAA |
EST members of Unigene | CO514060 CO512666 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3188.1.S1_at
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |