| Detail of EST/Unigene TCMS40876 |
| Acc. | TCMS40876 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable UDP-glucose 6-dehydrogenase 1 OS=Arabidopsis thaliana E-value=0; UDP-glucose 6-dehydrogenase OS=Glycine max E-value=0; Probable UDP-glucose 6-dehydrogenase 2 OS=Arabidopsis thaliana E-value=0; UDP-glucose 6-dehydrogenase OS=Drosophila melanogaster E-value=3e-75; UDP-glucose 6-dehydrogenase OS=Mus musculus E-value=9e-73; |
| Length | 730 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); MS_TRI2 (1 ESTs); |
| Sequence | CATTTCTCAGATCTCTCTCTTCCTTCTTCCAATCTCAACCATTCCTTAACTAAGGTTGCT |
| EST members of Unigene | CO516976 EX522369 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00012 UDPglucose 6-dehydrogenase |
| EC | 1.1.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2895.1.S1_at
|
| Corresponding NCBI Gene | 839197 |
| Trichome-related Gene from Literature | N/A |