Detail of EST/Unigene TCMS41023 |
Acc. | TCMS41023 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=5e-65; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=4e-64; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=4e-64; Glutathione S-transferase U22 OS=Arabidopsis thaliana E-value=1e-62; Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=1e-61; |
Length | 563 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (4 ESTs); |
Sequence | ACACATTTCTTTTCTTCTTCTTCCATAACAATTCTTCATTCTTTTCTTTCTGTGTTAATC |
EST members of Unigene | CO513935 CO512266 CO512017 CO512012 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
AFFX-Msa-gsta-3_at, Msa.1237.1.S1_s_at, Msa.2983.1.S1_at
|
Corresponding NCBI Gene | 844174 |
Trichome-related Gene from Literature | N/A |