Detail of EST/Unigene TCMS41127 |
Acc. | TCMS41127 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=6e-47; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=9e-45; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=1e-44; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=1e-44; Serine hydroxymethyltransferase, mitochondrial OS=Oryctolagus cuniculus E-value=2e-44; |
Length | 483 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); MS_TRI2 (1 ESTs); |
Sequence | CAACAACAACAACAAAGTCACACACAACAGTACATCACCACTGTCGTGCTCTTTTCTTTG |
EST members of Unigene | CO516231 EX522862 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2849.1.S1_at
|
Corresponding NCBI Gene | 827027 |
Trichome-related Gene from Literature | N/A |