Detail of EST/Unigene TCMT40255 |
Acc. | TCMT40255 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Citrullus lanatus E-value=6e-27; Cysteine synthase OS=Spinacia oleracea E-value=5e-26; Cysteine synthase OS=Solanum tuberosum E-value=9e-26; Cysteine synthase OS=Brassica juncea E-value=4e-25; Cysteine synthase OS=Zea mays E-value=2e-24; |
Length | 460 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); |
Sequence | CCTAGATGAAGTTATTCAGGTTTCAAGTGAAGAAGCTATAGAAACTGCTAAGCTGCTTGC |
EST members of Unigene | AL385320 AL385319 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37281.1.S1_at
|
Corresponding NCBI Gene | 819654 |
Trichome-related Gene from Literature | N/A |