| Detail of EST/Unigene TCMT41111 |
| Acc. | TCMT41111 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=8e-83; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=4e-75; Beta-glucosidase 1 OS=Arabidopsis thaliana E-value=9e-66; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-64; Beta-glucosidase 32 OS=Oryza sativa subsp. japonica E-value=6e-64; |
| Length | 664 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
| Sequence | CTTCTTAAAAATGGAATACAAAAATGTTTGACGGAATATACAGAAAGAAAAAAAACATAA |
| EST members of Unigene | BF649153 AI974286 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5178.1.S1_s_at
|
| Corresponding NCBI Gene | 839435 |
| Trichome-related Gene from Literature | N/A |