Detail of EST/Unigene TCMT43755 |
Acc. | TCMT43755 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase small chain OS=Nicotiana tabacum E-value=6e-31; Putative ribonucleoside-diphosphate reductase small chain B OS=Arabidopsis thaliana E-value=3e-29; Ribonucleoside-diphosphate reductase small chain C OS=Arabidopsis thaliana E-value=3e-29; Ribonucleoside-diphosphate reductase small chain A OS=Arabidopsis thaliana E-value=2e-25; Ribonucleoside-diphosphate reductase small chain OS=Spisula solidissima E-value=4e-22; |
Length | 844 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (2 ESTs); MT_SIRRA (1 ESTs); MT_Drought (1 ESTs); |
Sequence | GTTGGGATGAATGGGGGTTTGATGAGNACGTATATTGAGTTTGTTGCTGATAGGTTATTG |
EST members of Unigene | BI269319 AL372393 AL372388 BG450232 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
EC | 1.17.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12583.1.S1_at
|
Corresponding NCBI Gene | 822324 |
Trichome-related Gene from Literature | N/A |