Detail of EST/Unigene TCMT44400 |
Acc. | TCMT44400 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate, phosphate dikinase, chloroplastic OS=Flaveria pringlei E-value=2e-18; Pyruvate, phosphate dikinase, chloroplastic OS=Flaveria brownii E-value=2e-18; Pyruvate, phosphate dikinase, chloroplastic OS=Flaveria bidentis E-value=4e-18; Pyruvate, phosphate dikinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-18; Pyruvate, phosphate dikinase 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-18; |
Length | 685 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (6 ESTs); |
Sequence | CACACCCACACGACTCTATTCAAACTTCTTGAAACAACAATAATAAAATACCATTACTTT |
EST members of Unigene | BQ156357 BQ155414 BQ154985 BQ154740 BQ153904 BQ153520 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41427.1.S1_at
|
Corresponding NCBI Gene | 827226 |
Trichome-related Gene from Literature | N/A |