Detail of EST/Unigene TCMT45109 |
Acc. | TCMT45109 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Primary amine oxidase OS=Pisum sativum E-value=5e-67; Primary amine oxidase (Fragment) OS=Lens culinaris E-value=3e-66; Primary amine oxidase OS=Arabidopsis thaliana E-value=3e-36; Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-20; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-20; |
Length | 712 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (2 ESTs); MTFLOW (1 ESTs); |
Sequence | ATCGGAAACACATCGGATACGTTTGTCGGCAATCCAGCTCATCCACTTCTAACCGAAGAT |
EST members of Unigene | BQ156782 BQ156071 AJ497695 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K11182 diamine oxidase |
EC | 1.4.3.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.44895.1.S1_at
|
Corresponding NCBI Gene | 840058 |
Trichome-related Gene from Literature | N/A |