| Detail of EST/Unigene TCMT45109 |
| Acc. | TCMT45109 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Primary amine oxidase OS=Pisum sativum E-value=5e-67; Primary amine oxidase (Fragment) OS=Lens culinaris E-value=3e-66; Primary amine oxidase OS=Arabidopsis thaliana E-value=3e-36; Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-20; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-20; |
| Length | 712 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (2 ESTs); MTFLOW (1 ESTs); |
| Sequence | ATCGGAAACACATCGGATACGTTTGTCGGCAATCCAGCTCATCCACTTCTAACCGAAGAT |
| EST members of Unigene | BQ156782 BQ156071 AJ497695 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K11182 diamine oxidase |
| EC | 1.4.3.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44895.1.S1_at
|
| Corresponding NCBI Gene | 840058 |
| Trichome-related Gene from Literature | N/A |