| Detail of EST/Unigene TCMT45203 |
| Acc. | TCMT45203 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Tyrosine aminotransferase OS=Arabidopsis thaliana E-value=2e-46; Nicotianamine aminotransferase B OS=Hordeum vulgare E-value=2e-45; Probable aminotransferase TAT2 OS=Arabidopsis thaliana E-value=1e-44; Nicotianamine aminotransferase A OS=Hordeum vulgare E-value=7e-44; S-alkyl-thiohydroximate lyase SUR1 OS=Arabidopsis thaliana E-value=4e-39; |
| Length | 925 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); MT_ROOTPHOS (1 ESTs); |
| Sequence | AGATGGTTAGTTCCTGGTTGGAGAACTGGTTGGATAGCCACATGTGACCCCCACAAAATT |
| EST members of Unigene | AL387970 AL387969 AW329712 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.13654.1.S1_at
|
| Corresponding NCBI Gene | 833613 |
| Trichome-related Gene from Literature | N/A |