Detail of EST/Unigene TCMT45398 |
Acc. | TCMT45398 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=2e-54; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=4e-48; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=2e-44; Cytochrome P450 750A1 OS=Pinus taeda E-value=8e-31; Cytochrome P450 71A3 (Fragment) OS=Solanum melongena E-value=1e-29; |
Length | 705 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | ATTCATGGTCTTATTTGTCTCAAAATTCATCACCAACAAATACTTCAACTCTAAACATGG |
EST members of Unigene | BF646160 BQ139574 BE204573 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabo |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.38764.1.S1_at
|
Corresponding NCBI Gene | 829887 |
Trichome-related Gene from Literature | N/A |