Detail of EST/Unigene TCMT45721 |
Acc. | TCMT45721 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative UDP-glucose flavonoid 3-O-glucosyltransferase 3 OS=Fragaria ananassa E-value=5e-58; UDP-glucose flavonoid 3-O-glucosyltransferase 6 OS=Fragaria ananassa E-value=2e-57; Anthocyanidin 3-O-glucosyltransferase 2 (Fragment) OS=Manihot esculenta E-value=5e-57; Anthocyanidin 3-O-glucosyltransferase 1 OS=Manihot esculenta E-value=1e-55; UDP-glycosyltransferase 71B2 OS=Arabidopsis thaliana E-value=4e-54; |
Length | 572 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | ATCAGGTTAAAGAGATTGCACATGCTATTGAGAATTGTGGAGCCCGTTTTGTGTGGTCTC |
EST members of Unigene | BF520967 CX520110 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13969.1.S1_at
|
Corresponding NCBI Gene | 821730 |
Trichome-related Gene from Literature | N/A |