| Detail of EST/Unigene TCMT46121 |
| Acc. | TCMT46121 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase 7 OS=Arabidopsis thaliana E-value=0; 1-aminocyclopropane-1-carboxylate synthase CMA101 OS=Cucurbita maxima E-value=1e-90; 1-aminocyclopropane-1-carboxylate synthase 5 OS=Arabidopsis thaliana E-value=2e-89; 1-aminocyclopropane-1-carboxylate synthase 3 OS=Solanum lycopersicum E-value=2e-89; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=2e-89; |
| Length | 856 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); MT_HOGA (1 ESTs); |
| Sequence | TTCCCCTCCTTCTAAAATAGTTAGTATGGGTCTTGAGATTGAACAAGAAACCACCCTTGT |
| EST members of Unigene | BG645853 CB893201 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.20234.1.S1_at
|
| Corresponding NCBI Gene | 828726 |
| Trichome-related Gene from Literature | 828726 |