Detail of EST/Unigene TCMT46297 |
Acc. | TCMT46297 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=9e-30; Beta-glucosidase 47 OS=Arabidopsis thaliana E-value=2e-29; Probable inactive beta-glucosidase 14 OS=Oryza sativa subsp. japonica E-value=5e-28; Beta-glucosidase 45 OS=Arabidopsis thaliana E-value=1e-27; Putative beta-glucosidase 15 OS=Oryza sativa subsp. japonica E-value=3e-27; |
Length | 719 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
Sequence | TTCAACCTTTATCTTTAAAATACAACATTTCACTTGAGAGAAATCTGAATGGTGAGAATC |
EST members of Unigene | AL383694 AW257251 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8347.1.S1_at
|
Corresponding NCBI Gene | 842479 |
Trichome-related Gene from Literature | N/A |