Detail of EST/Unigene TCMT46299 |
Acc. | TCMT46299 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 39S ribosomal protein L10, mitochondrial OS=Rattus norvegicus E-value=5e-10; 39S ribosomal protein L10, mitochondrial OS=Bos taurus E-value=5e-10; 54S ribosomal protein L11, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=9e-10; 39S ribosomal protein L10, mitochondrial OS=Homo sapiens E-value=1e-09; 39S ribosomal protein L10, mitochondrial OS=Mus musculus E-value=1e-08; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); |
Sequence | AGGTTTACCTTTATAATTTATATTACGCGCAACTTCATTTTAATAGATTGGTTTTTATAA |
EST members of Unigene | AL389380 AL389379 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8379.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |