Detail of EST/Unigene TCMT46544 |
Acc. | TCMT46544 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Spermidine synthase 2 OS=Pisum sativum E-value=0; Spermidine synthase 1 OS=Pisum sativum E-value=0; Spermidine synthase 2 OS=Arabidopsis thaliana E-value=8e-96; Spermidine synthase OS=Solanum lycopersicum E-value=2e-93; Spermidine synthase 1 OS=Arabidopsis thaliana E-value=2e-93; |
Length | 1059 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY (2 ESTs); MT_CDS (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | CTAGCTATCACTTTCGGTTATTCTTTTGAACAAACACGTAACATGCATAATACTAATATC |
EST members of Unigene | BT051700 EV255598 DW017867 DW016148 BQ139676 BF641340 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39936.1.S1_at
|
Corresponding NCBI Gene | 843367 |
Trichome-related Gene from Literature | N/A |