Detail of EST/Unigene TCMT46567 |
Acc. | TCMT46567 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=3e-66; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=6e-66; Glutathione S-transferase OS=Hyoscyamus muticus E-value=1e-65; Glutathione S-transferase F7 OS=Arabidopsis thaliana E-value=1e-59; Glutathione S-transferase F6 OS=Arabidopsis thaliana E-value=5e-59; |
Length | 803 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | GGACAAAATACCATAGTAAATTAAGAGCTATACACCATACTACATACATATCTGCAAAAT |
EST members of Unigene | BQ140748 EY475871 GE350620 GE345702 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40518.1.S1_at
|
Corresponding NCBI Gene | 839295 |
Trichome-related Gene from Literature | N/A |