Detail of EST/Unigene TCMT46839 |
Acc. | TCMT46839 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=0; |
Length | 1671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (4 ESTs); MT_CDS (3 ESTs); MT_DLEAF (3 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_DSTEM2 (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | GCTCATAACTTGCAAACATAACATCAAAAGATAGAATTATCAAAAATGGGAAACTTTGCA |
EST members of Unigene | BT052701 BT052014 DQ875463 CX526653 CX525576 CX525436 CX524271 AW694485 EV262749 EV257447 BE316273 BF637316 BF637133 BF637894 BG449564 BF642382 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.46609.1.S1_at
|
Corresponding NCBI Gene | 838843 |
Trichome-related Gene from Literature | N/A |