| Detail of EST/Unigene TCMT46895 |
| Acc. | TCMT46895 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucose flavonoid 3-O-glucosyltransferase 7 OS=Fragaria ananassa E-value=8e-97; UDP-glycosyltransferase 73B4 OS=Arabidopsis thaliana E-value=2e-89; UDP-glycosyltransferase 73B5 OS=Arabidopsis thaliana E-value=1e-87; Anthocyanin 3'-O-beta-glucosyltransferase OS=Gentiana triflora E-value=1e-85; UDP-glycosyltransferase 73C6 OS=Arabidopsis thaliana E-value=3e-85; |
| Length | 1719 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (4 ESTs); MT_DSIL (3 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_PhoLEAF (1 ESTs); |
| Sequence | GAGATACACTCACACACTAGTAGAGATAGAAACTTTGATACGTGAATAGAGAGAGAATAA |
| EST members of Unigene | EV255431 DW018574 BE249807 BE316178 BE318227 BE249303 BF521149 BF519951 AW981311 BF638704 BG448847 BF639590 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43628.1.S1_at
|
| Corresponding NCBI Gene | 816041 |
| Trichome-related Gene from Literature | N/A |