Detail of EST/Unigene TCMT48957 |
Acc. | TCMT48957 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Proliferating cell nuclear antigen OS=Pisum sativum E-value=5e-79; Proliferating cell nuclear antigen (Fragment) OS=Glycine max E-value=2e-78; Proliferating cell nuclear antigen OS=Nicotiana tabacum E-value=4e-77; Proliferating cell nuclear antigen OS=Daucus carota E-value=2e-76; Proliferating cell nuclear antigen OS=Catharanthus roseus E-value=3e-76; |
Length | 783 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); MTFLOW (1 ESTs); |
Sequence | TTTTTTGTGGTTATGTGATGAAGCCCAAGACAAGATTTCTGATTTTGAGATGAAGCTGAT |
EST members of Unigene | EV259713 AJ497831 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K04802 proliferating cell nuclear antigen; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K04802 proliferating cell nuclear antigen; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K04802 proliferating cell nuclear antigen; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K04802 proliferating cell nuclear antigen |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2564.1.S1_at, Mtr.4350.1.S1_at
|
Corresponding NCBI Gene | 817506 |
Trichome-related Gene from Literature | N/A |