| Detail of EST/Unigene TCMT49022 |
| Acc. | TCMT49022 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D11 (Fragment) OS=Lotus japonicus E-value=3e-53; Cytochrome P450 71D10 OS=Glycine max E-value=8e-52; Cytochrome P450 71D9 OS=Glycine max E-value=2e-51; Cytochrome P450 71D8 OS=Glycine max E-value=8e-51; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=4e-50; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2 (1 ESTs); MT_KVKC (1 ESTs); |
| Sequence | CCCGGGCTGCGGTGGAGTTAGGGTTTCATCTTCTCATATCAACTATCCTTGGTTTCCTCT |
| EST members of Unigene | AW191204 BQ255368 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44937.1.S1_at
|
| Corresponding NCBI Gene | 832566 |
| Trichome-related Gene from Literature | N/A |