| Detail of EST/Unigene TCMT49195 |
| Acc. | TCMT49195 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=2e-46; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=8e-44; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=1e-38; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=1e-36; 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic OS=Zea mays E-value=7e-14; |
| Length | 621 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
| Sequence | CGAACATTTGCATCTTCATAAAGTGATGCAAACAATGCAATGAACTTTACAAATATCAAT |
| EST members of Unigene | CX527441 BQ141275 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10122.1.S1_at
|
| Corresponding NCBI Gene | 825527 |
| Trichome-related Gene from Literature | N/A |